Well.

I guess I need to dumb things down a bit, eh? Once again, my candle is blown out so someone else's can look brighter.

I'm sorry if the depth and intellect of my blog evades your understanding. I guess the pure genius of my writing ...

yeah, forget it. I can't finish this...I started out on a roll then figured some of your readers might think I'm serious.

Damn. I kill me.
John | Homepage | 02.25.05 - 11:04 pm | #

It's because I posted about my cat, isn't it. Does it help my case that I threw it bodily out the door?
Mamacita | Homepage | 02.25.05 - 11:09 pm | #

Damn, I knew thinking out loud would have its repercussions.
zee | Homepage | 02.25.05 - 11:15 pm | #

This idiot is still trying to figure out WHICH idiot category, I belong in. heehee! You guys are NUTS, but that's why I like your site!
Truewillow | Homepage | 02.25.05 - 11:33 pm | #

He's talking about me! ME ME ME!!! All his posts are about me!

Ahem.

What?
UV | Homepage | 02.25.05 - 11:38 pm | #

I knew you'd see through me. Am I really that transparent... oh I guess I am since obviously i was self centered enough to assume you were talking about me.
Square1 | Homepage | 02.26.05 - 1:20 am | #

You're so vain... you prob'ly think this post is about you.

Sing it everyone!
Square1 | Homepage | 02.26.05 - 1:21 am | #

Oh come on Square...there has got to be a different song that'll make the same point.
John | Homepage | 02.26.05 - 2:24 am | #

I know, it's "I Don't Want To Work" by Todd Rundgren. (I want to bang on the drum all day!) Huh-yup.
*totally off the wall idiot*
styx | Homepage | 02.26.05 - 9:52 am | #

I saw a large bunch of MENSA members get thrown out -- PERMANENTLY - of a Chinese restaurant that they had previously patronized every Sunday for a year. It was because they couldn't figure out how to deal with an additional side order of vegetables which none of them admitted to having ordered.
Melinama | Homepage | 02.26.05 - 11:11 am | #

It is not worth an intelligent man's time to be in the majority. By definition, there are already enough people to do that. --- G. H. Hardy
Melinama | Homepage | 02.26.05 - 11:46 am | #

lol @ square1! i thought about that song too...i forgot what i wanted to say too...
lani | Homepage | 02.26.05 - 12:22 pm | #

Here's a good one:

Human Genome Project scientists announced a significant breakthrough in cracking the genetic code today. They disclosed that they have solved the long-standing problem of why only a small fraction of the DNA strand is actually used by the cell to code for proteins, while the rest seems to be just unused "junk".

The crux of the discovery was the amino acid sequence:

ATGCATGGACTGATCTAGTCATGCTGACTGGTACATACCGAATCAGTACC ATGGACATATACAGTAC
GTTACCGTGACCTCAGTCAATGGCCATCTCGTGACTTCGATCTACTGAAA TCCATGATCATAGCATG
ATCAGTCCTACGTAGCATGCAATGCATGCATATAGCATATCACATTATAC GACTACGTACATGACGT
ACCGTAGTACATCAGG

which was found to decode to:

"this space intentionally left blank."

hahahahahahaha
Isabella | Homepage | 02.26.05 - 3:16 pm | #

ROTFLOL Isabella!
Square1 | Homepage | 02.26.05 - 3:26 pm | #

LOL, Isabella!
zee | Homepage | 02.26.05 - 6:39 pm | #

lol@ sequence. Its the wrong sequence, you can't have TT. Whoz DNA was that BTW!
blaze | 02.27.05 - 10:46 am | #

Earlier today I had a really intelligent comment that I tried to post but HaloScan ate it and then wouldn't let me comment. Now I can't remember what I said so you'll never know.
Lynn S | Homepage | 02.28.05 - 7:57 pm | #